Chst10 antibody thermo
WebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. WebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG ... Conjugate Unconjugated Immunogen A synthesized peptide derived from human CHST10, corresponding to a region within the internal amino acids. Form Liquid Concentration 1mg/mL Purification Affinity …
Chst10 antibody thermo
Did you know?
WebATP7B Antibodies. Antibodies that detect ATP7B can be used in several scientific applications, including Western Blot, Immunocytochemistry, Immunohistochemistry, Immunoprecipitation and ELISA. These antibodies target ATP7B in Human, Rat and Mouse samples. Our ATP7B polyclonal and monoclonal antibodies are developed in Rabbit … WebIHC-P analysis of human lung carcinoma tissue using GTX87551 CHST10 antibody. The picture on the right is blocked with the synthesized peptide. GTX87551 WB Image WB analysis of HUVEC cell lysates using …
WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate … WebThermo Fisher Scientific's CHST10 Antibody is a Rabbit Polyclonal antibody. This antibody has been shown to work in applications such as: Immunohistochemistry, …
WebCHST10, Rabbit anti-Human, Polyclonal Antibody, Abnova™-Rabbit Polyclonal Antibody WebCompare Anti-CHST10 Immunohistochemistry Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
WebType Antibody Immunogen A synthetic peptide derived from the internal region of human CHST10 Conjugate Unconjugated Form Liquid Concentration 1mg/ml Purification … dialysis machine 2008tWebAntibodies. Protein structure ... CHST10 is part of cluster 22 Rhabdoid cancers - Neuronal signaling with confidence i 1 291 genes in cluster Go to interactive expression cluster page. 15 nearest neighbours based on cell line RNA expression. Neighbour i. Description i. ... cipriani \u0026 werner hunt valley mdWebAnti-CHST10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution; Synonyms: Anti-Carbohydrate sulfotransferase 10,Anti-HNK-1 sulfotransferase,Anti-HNK-1ST,Anti-HNK1ST,Anti-huHNK-1ST; find Sigma-Aldrich-HPA012884 MSDS, related peer … cipriani \u0026 werner charleston wvWebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG Class Polyclonal Type Antibody Conjugate … cipriani \\u0026 werner blue bell paWebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … dialysis low hemoglobinWebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238IR). Every product we sell is backed by Novus' 100% Guarantee . If you … dialysis lubbock texasWebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238R). Every product we sell is backed by Novus' 100% Guarantee . If you … cipriani \\u0026 thomas law offices